Chloroplast DNA sequences have become a useful tool for the study of plant taxonomy, phylogeny, and population genetics. Chloroplasts are sub-cellular organelles with their own DNA which is unlike the genomic DNA of a plant because it is inherited in a non-Mendelian way from one parent only. Because of this, it does not undergo recombination and therefore has a highly conserved gene order.
Chloroplast DNA is a circular molecule ranging from 120 to 217 kilobase pairs in photosynthetic land plants. The extraction of chloroplast DNA from plant DNA is an arduous and chemically complex process making analysis of chloroplast DNA sequences difficult. Once the complete sequences of cpDNA from a variety of plants became available, this led to the design of universal primers, which can amplify non-coding regions of DNA using the polymerase chain reaction. This eliminates the need for extraction of cpDNA. Once amplified, these non-coding sequences can be analyzed through a variety of molecular genetics techniques which allow the determination of variability within and between plant species.
In today’s lab you will set up a PCR reaction using total cellular DNA that has been prepared for you from a plant (bean, pea, etc.) and a fungus. In your PCR reaction, you will use universal primers to amplify a non-coding region of cpDNA in the plant. These primers are anchored within a region of the cpDNA that codes for transfer RNA. Specifically, we will be amplifying a region between the tRNA genes referred to as trnH and trnK. A list of primers for chloroplast and mitochondrial genes for plants can be found here. The ones we're using are at the top of this list. Since these genes are found in all chloroplast genomes, they will work in almost all photosynthetic land plants. Also, since fungi don't have chloroplasts we expect not to amplify this region in the fungal sample. We can expect, therefore, to see the amplification product for the plant sample on the gel, and it should be approximately the size of the intergenic spacer region (about 500 bp).
The specific procedure you will follow changes slightly each
semester, so you'll be given a handout of this in lab (or
you can link to one here). Basically,
you will mix reagents together the first week and have the lab
assistant run them in a thermocycler to produce PCR products.
Then next week, we will resolve these PCR products on gels.
For your lab grade this week, you must complete the following
assignment. This involves BLAST searching an unknown sequence
(homologous to the PCR products you obtain in the lab), and answering
several relatively easy questions about the results of your
search. You instructor will go over the procedure you will
follow. The due date for this assignment will be given by your
lab instructor.
Homework Assignment:
For homework, you will visit a NCBI website that maintains sequence information and search the site to identify sequences similar to one we will give you.
Imagine that you've obtained PCR products from an unknown plant and you want to find out what it is. You would do the PCR reaction discussed above to amplify a known portion of the chloroplast genome. Then you can obtain the sequence of this amplified region using a process that is basically another PCR amplification, but which identifies the position of nucleotides in the DNA. This would require additional work on your part, but assume that you've already done this and obtained the sequence for a given chloroplast gene.
The site you will visit is the NCBI online source of molecular biology information. When DNA or protein sequence information is collected by investigators, it is sent to this site and made available to anyone worldwide. We will use one of the services available at the site to BLAST search for sequences similar to our target sequence. BLAST stands for Basic Local Alignment Search Tool, and it enables an investigator to rapidly identify sequences available at NCBI that are similar to a given target sequence. Your objective is to search for sequences similar to an unknown we will give you.
Procedure:
1. Which sample appears from your results to have been the plant DNA
sample?
2. Visit the BLAST page of the NCBI website. Read the introduction and overview of BLAST searching.
3. In the Nucleotide box, click on "Nucleotide-nucleotide BLAST (blastn)"
4. You now must load the sequence of your DNA sample, and the program will search for similar sequences. Copy the following DNA sequence from your unknown and paste it into the window labeled "search". Choose the database you want to search ("other"); the default database is the human genomic plus transcript database, which wouldn't make much sense for our search. Then click "BLAST!"; when the time given to complete the search is up, click "Format!" [If this doesn't work the first time do it again]
TTGGTTACATCCGCCCCCCACTATCTGCAAAATAAAATCTACAAACTAAAAAAAAATACAAAGATTGAAA
TTTCTAACATTGATCATCTTTTTTTATCTTTATTTTTTTATCTTACCTTAATTCTGAAGATACAAATGAA
GAGGCAAGAGGCAGAAAATGCCAAACTTTCTTTTTTATATTAAATTGACTCTAAAATAATAATCTGACTG
TAAAGTAATAATAACAATAACTAAAGGCAAATTAAATTATTAGCACATAGTAATAATATGATACTAAATA
AAAAGGCATAAAAAACTTTGTGTTTTGTTGAAGTAAAAAAAGGACAGAAATAAAAAAAAACCTAATAAAT
AACGGAGCAATACCAATAAATTGGTATTGCTCCGTTATTTTCAAAAACTCGTATACACGAAGATCGAAAT
CTTATCCATTTGTAGATGGAGCTTCAATAGCAGCTAGGTCTAGAGGGAAATTATGAGCATTACGTTCATG
CATAACTTCCATACCAAGGTTAGCGCGGTTAATAATATCAGCCCAGGTATTAATTACACGACCTTGACTA
TCAACTACGGATTGGTTGAAATTAAAACCGTTTAGGTTGAAAGCCATAGTGCTAATACCTAAAGCAGTAA
ACCAGATACCTACTACAGGCCAAGCAGCTAGAAAGAAGTGTAAAGAACGAGAGTTGTTGAAACTAGCATA
TTGAAAGATCAATCGGCCAAAATAACCATGAGCAGCTACAATATTATAAGTTTCTTCCTCTTGACCGAAT
CTGTAACCTTCATTAGCAGATTCGTTTTCTGTGGTTTCCCTGATCAAACTAGAGGTTACCAAGGAACCAT
GCATAGCACTGAATAGGGAGCCGCCGAATACACCAGCTACGCCTAACATGTGAAATGGGTGCATAAGGAT
GTTGTGCTCCGCCTGGAATACAATCATGAAGTTGAAAGTACCAGAGATTCCTAGAGGCATACCATCAGAA
AAACTTCCTTGACCAATTGGGTAAATCAAGAAAACAGCAGTAGCAGCTGCAACAGGAGCGGAATATGCAA
CAGCAATCCAAGGGCGCATACCCAAACGGAAACTAAGTTCCCACTCGCGACCCATGTAACAAGCTACACC
AAGTAAGAAGTGTAGAACAATTAGTTCATAAGGACCGCCATTGTATAACCATTCATCAACGGATGCCGCT
TCCCATATCGGGTAAAAGTGCAAACCTATAGCTGCAGAAGTAGGAATAATGGCACCAGAAATAATATTGT
TTCCATAAAGTAGAGATCCAGAAACGGGTTCACGAATACCATCAATATCCACTGGAGGGGCAGCAATGAA
GGCGATAATAAATACAGAAGTCGCGGTCAATAAGGTAGGGATCATCAAAACACCAAACCATCCGATGTAA
AGACGGTTTTCGGTGCTGGTTATCCAGTTACAGAAGCGACCCCATAGGCGTTCGCTTTCGCGTCTCTCTA
AAATTGCAGTCATGGTAAAATCTTGGTTTATTTAATCATCAGGGACTCCCAAGCATACAACTTTCTCGAA
ATAGATAATTGAGGGCTTGTTATTCAACAGTATAACATGACTTATAGCCCCGTGTCAACCAATAGCAACA
TCGATATCTCTGATCTTATCTATCTCGAAATTCATAAGAATTTTTTTTTGAATAATTGAATAAATAATAA
ATGAAATCAGTTCGAAAAAAAGAAATGCCGATTTATATCGATATATGATTATATGATTTTGATATGAAAA
TCAAAATGGGTTGCCCGGGACTCGAACCCGGAACTAGTCGG
5. Write down the names of the organisms that show up at the top of the search list. These have the highest sequence similarity to your unknown DNA.
6. Based on this search, what do you think may be the identity of the unknown?
7. How similar are the sequences of the unknown and the known sequences?
8. From which portion of the chloroplast gene is this sequence taken (note: it is the same portion that you amplified in lab)?
9. How confident are you in your identification of the unknown organism? What must you assume to know the actual identity of an unknown using this technique?
10. BLAST search the following sequence and determine the likely
identity
of the organism and
the chloroplast gene
from which it was amplified:
gagacgctac ggacttaaat aatttgagct ttagtagaaa aacttactaa atgcaagctttcaaattcag ggaaacttag gttgaaaaaa atataagcaa tcctgagcca aattttattgtatattaaaa ataaaatagg tgcagagact caatggaagc tatcctaaca aaaaaattttatattttatt taaataaatt ttattttata tttattaata aaaataaaat ctaatttatttataaattct ttttaaatat taatattaag cgaggataaa gatagagtcc aattttacatgttatgttaa ttttagcaac aatttaaatt gtagtaaaaa gaaaatccgt tggctttattgaccgtgagg gttcaagtcc ctctaccccc